Archivelago Indonesia Marine Library

Perpustakaan Kementerian Kelautan dan Perikanan Republik Indonesia

  • Home
  • Layanan
  • Informasi Umum
  • Pustakawan
  • FAQ
  • Koleksi Digital
    eBook dan Teks eBook
  • Select Language :
    Arabic Bengali Brazilian Portuguese English Espanol German Indonesian Japanese Malay Persian Russian Thai Turkish Urdu
No image available for this title

PDF

SEQUENCE ANALYSIS OF Streptococcus agalactiae, A PATHOGEN CAUSING STREPTOCOCCOSIS IN TILAPIA (Oreochromis niloticus)

Wartono Hadie - Personal Name; Taukhid - Personal Name; Angela Mariana Lusiastuti - Personal Name; Eny Kusrini - Personal Name;

Pathogen identification based on biochemical properties can barely differentiate Streptococcus iniae and S. agalactiae. Beside that, this technique is also limited by the length of time required to complete the assays. Therefore, rapid diagnosis is necessary to initiate prompt therapeutic and prophylactic measures in order to limit any potential economic losses caused by such pathogens. The aim of the present study was to identify Streptococcosis species using amplification of S. agalactiae DNA sequence with species-specific primer Sdi 61 AGGAAACCTGCCATTTGCG and Sdi 252 CAATCTATTTCTAGATCGTGG and perform phylogenetic analysis based on DNA nucleotide sequence data. The sequencing of PCR products was performed at BPPT Puspiptek Serpong by using the respective PCR primers, Big Dye Terminator Chemistry and AmpliTaq-FS DNA polymerase. The sequencing reactions were run on the ABI Prism version 3103 – Avant Genetic Analyzer (USA) and the result was read by Sequence Navigator program (Applied Biosystem). Alignment multiple analysis was done based on the data from Genebank with BLASTN (http://blast.ncbi.nlm.nih.gov/blast.cgi) on the nucleotide level. Neighbor-joining phylogenetic trees were generated with Genetyx programme version 7 with UPGMA and MEGA software version 4.0. The result revealed that the isolates from brain, eye, and kidney of diseased Tilapia were infected by S. agalactiae and it has 99% similarity with Genebank. It has close relationship with S. agalactiae at genebank with UPGMA method. These isolates showed high variation in the first sequence which is similar to S. iniae. The information of S. agalactiae genomes suggests that gene acquisition, duplication, and reassortment have played an important role in genetic diversity and evolution of S.agalactiae. Screening of breeder fish stocks with the developed PCR methodology, followed by elimination of infected stocks, would provide an efficient strategy to control fish infected by streptococcosis.


Availability
B1707369Koleksi DigitalArchivelago Indonesia Marine Library - Perpustakaan Kementerian Kelautan dan PerikananAvailable
Detail Information
Series Title
-
Call Number
Koleksi Digital
Publisher
Bogor : Indonesian Aquaculture Journal., 2009
Collation
-
Language
English
ISBN/ISSN
-
Classification
NONE
Content Type
-
Media Type
-
Carrier Type
-
Edition
-
Subject(s)
Jurnal
Local Content
Publikasi Internal
streptococcus agalactiae
tilapia
Sequence analysis
Specific Detail Info
-
Statement of Responsibility
-
Other version/related

No other version available

File Attachment
  • Please login to see this attachment
Comments

You must be logged in to post a comment

Archivelago Indonesia Marine Library
  • Maklumat
  • Pathfinder
  • Pengajuan ISBN dan ISSN
  • Area Keanggotaan
  • Katalog Integrasi
  • Kanal Pengaduan
  • Sejarah Archivelago

About Us

Archivelago Indonesia Marine Library yang berasal dari gabungan kata ‘archive’ dan ‘archipelago’ yang memiliki makna tempat yang paling sesuai dan lengkap untuk menyimpan informasi mengenai kelautan dan perikanan Indonesia, merupakan perpustakaan khusus di bawah Sekretariat Jenderal Kementerian Kelautan dan Perikanan, dengan koleksi khusus di bidang kelautan dan perikanan.

Search

start it by typing one or more keywords for title, author or subject

Keep SLiMS Alive Want to Contribute?

© 2025 — Senayan Developer Community

Powered by SLiMS
Chat With Librarian

Please type your name before starting in conversations.


You may also hit Enter button to starting in conversation.
Select the topic you are interested in
  • Perikanan Tangkap
  • Perikanan Budidaya
  • Pengolahan Ikan
  • Pulau Kecil
  • Masyarakat Pesisir
  • Local Content
  • Ekspor Perikanan
  • Illegal Fishing
  • Ilmu - Ilmu Sosial
  • Geografi dan Sejarah
Icons made by Biro Humas dan KLN Kementerian Kelautan dan Perikanan from www.kkp.go.id
Advanced Search